Gene Therapy could treat cancer!

Started by Mithlomwen, March 23, 2013, 09:12:08 AM

Previous topic - Next topic

0 Members and 1 Guest are viewing this topic.

Mithlomwen

http://gma.yahoo.com/gene-therapy-could-treat-cancer-study-finds-013014284.html

QuoteA clinical trial using a patient's own immune system to produce remissions in adults with acute leukemia could be a major breakthrough in the fight against all different kinds of cancer.

The new study, published Wednesday in the journal Science Translational Medicine, took five patients with untreatable cancer, and using their own immune systems, injected genetic material into the patient's white cells to turn them into cancer fighters. The modified white cells then went out in the body and destroyed all the cancer cells, causing the patients to go into remission, according to the study.

"Cancer cells are similar enough to your normal cells that the T-cells cannot recognize it," Dr. Richard M. Stone, Program Director of the Adult Leukemia Program at the Dana-Farber Cancer Institute, told ABC News. "By injecting genes into these cells, you're educating the immune system to recognize the cancer."

This study only reviewed patients with acute lymphoblastic leukemia. While 80 to 90 percent of children with ALL can be cured with conventional therapy, adult ALL is genetically different and only enjoys a cure rate of roughly 40 percent.

Of the five patients, four had bone marrow transplants after receiving the new treatment. The other patient suffered medical problems that made a transplant impossible, relapsed and died shortly thereafter.

One of the patients, known in the study as Patient 5, is David Aponte, 58, a sound man at ABC News.

Last summer, Aponte underwent a physically and emotionally taxing regimen of chemotherapy. However, while still undergoing treatment, doctors discovered that the disease was back. With few options left, he decided to join the new T-cell study.

Doctors took millions of Aponte's disease-fighting white blood cells, and used a retrovirus to change those cells into targeted cancer fighters. The treatment can cause side effects, including what is known as a "cytokine storm," in which the engineered T-cells become activated, releasing all kinds of proteins that can make the patient ill. For Aponte, this meant a drop in blood pressure, a fever that spiked to 105 degrees and a coma that lasted eight days.

"Down the road if this continues to be developed, one could imagine therapies that would modulate the side effects, slowing down the anti-tumor response," explained Dr. Stone.

Aponte's treatment was successful, and he became one of the patients who successfully went into remission. When he awoke from the coma, not one cancer cell could be found. His leukemia was gone.

Last December, ABC News told a similar story of an 8-year-old girl with this particular type of leukemia who was treated using her own cells that had been genetically modified. Today, Emma Brooke Whitehead is in total remission.

"This is a very exciting development and part of a new avenue of therapy for patients with cancer," Dr. Aaron Rapoport, the Gary Jobson Professor in Medical Oncology at the University of Maryland School of Medicine and Marlene and Stewart Greenebaum Cancer Center, told ABC News. "With this new gene transfer technology, we are able to engineer a patient's immune cells to attack their own cancer."

Dr. Rapoport conducts research that uses genetically modified T-cells to treat myeloma, a cancer of plasma cells, further evidence that this kind of treatment could be possible for treating both blood and non-blood cancers in the future.

ABC News' Richard Besser, Dan Childs and Dr. Ajanta Patel contributed to this report

I find this extremely exciting and very promising.  If this will work for other types of cancer, medical science might well be on its way to ending cancer. 
Baby, it's all I know,
that your half of the flesh and blood that makes me whole...

Hades

Only having five subjects in the study does make it a bit more problematic, since you want to have as large a sample size as possible.   That being said, alot of times medical breakthroughs do come from noticing a change in a small group and then taking it large scale so it's not that big of a hurdle to overcome.

That said, there seems to be alot of good news in the medicial field the past few weeks.   This study, breakthroughs in the treatment of HIV/AIDS and others really gives me cause to be optimistic that maybe within my lifetime there will be a viable cure or perhaps a means of prevention after all.

MHaji

Here's a much more detailed account from the New York Times.

This is remarkable work. However, note that not all 5 survived, and the ones that did also received bone marrow transplants.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA