News:

Main Menu

Riddles

Started by MHaji, March 13, 2009, 02:31:07 AM

Previous topic - Next topic

0 Members and 1 Guest are viewing this topic.

MHaji

I love riddles, but I've yet to see a riddle thread. So, here's one to start with:

Dark when it's still, and aglow when it goes -
Its eye's in its belly, its tail's on its nose.


Anybody got any others?
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

Transgirlenstein

Not sure about that one.  My favorites are:

What is it no man wants to have but no man wants to lose?

There are three men in a boat with four cigarettes and no matches.  How do they manage to smoke?

What has four fingers and a thumb?

The man who builds it doesn't need it, the man who buys it doesn't use it, the man who uses it doesn't want it. What is it?
Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

saturnschild

Why is a Raven like a writing desk?

yeah try to figure that on out.
The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

Sephora

I can travel around the entire world; all while staying in one corner.  What am I?

Transgirlenstein

Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

Sephora

Nope!  ^___^ Want me to tell you?

Transgirlenstein

Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

Sephora


Transgirlenstein

Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

MHaji

QuoteWhat is it no man wants to have but no man wants to lose?

Hmm. A sixth finger on his hand? A bit out there... a prosthetic, like a hearing aid, wooden leg, or glass eye? A fight to the death? One, and only one, appeal to a death sentence? I think there're lots of answers.

QuoteThere are three men in a boat with four cigarettes and no matches.  How do they manage to smoke?

If one had a cigarette already lit, they could light off of it. Alternatively, they were struck by lightning and all caught on fire.

QuoteWhat has four fingers and a thumb?

A person with one hand? A hand with a missing digit, because the thumb is a finger? Something hand-shaped, like a glove or a wooden hand?

QuoteThe man who builds it doesn't need it, the man who buys it doesn't use it, the man who uses it doesn't want it. What is it?

Heard this one.

QuoteWhy is a Raven like a writing desk?

Lewis Carroll never gave an answer, but there are a few good ones.

QuoteI can travel around the entire world; all while staying in one corner.  What am I?

Heard this one; my initial answer, "A person who is in a perpetual coma, sleeps in a corner bed, and is highly imaginative" was deemed too morbid.

Another of mine:

Errors we'll own to, if we're wise;
What Gollum runs for exercise.
(Hint: one word, six letters.)
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

Bliss

Quote from: MHaji on March 13, 2009, 10:24:02 AM

There are three men in a boat with four cigarettes and no matches.  How do they manage to smoke?

If one had a cigarette already lit, they could light off of it. Alternatively, they were struck by lightning and all caught on fire.

...they have a lighter, would be my guess. *grin* Or if they want to get tricky and someone has glasses they can try to focus the sunlight.


O/O ~ Wiki ~ A/A ~ Discord: Bliss#0337
I must not fear. Fear is the mind-killer. Fear is the little-death that brings total obliteration. I will face my fear. I will permit it to pass over me and through me. And when it has gone past I will turn the inner eye to see its path. Where the fear has gone there will be nothing.
Only I will remain.
<3 <3 <3

MHaji

Bliss: Oooh, yes, that's a definite possibility. But I wondered what the purpose of the fourth cigarette was, in that case.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

Transgirlenstein

There are three men in a boat with four cigarettes and no matches.  How do they manage to smoke?
They throw one cigarette overboard and make the boat a cigarette lighter.

What has four fingers and a thumb?
A glove

What is it no man wants to have but no man wants to lose?
A lawsuit

Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

Marguerite

QuoteThe man who builds it doesn't need it, the man who buys it doesn't use it, the man who uses it doesn't want it. What is it?

A casket to put the dead in.
*R.R*A.A*O.O*Wiki*Bordello*Whip and Apple*
You Keep On Crying, Baby, I'll Bleed You Dry
Mar Is Currently: Taking On Threads
Check My Absence Thread For Updates, Thank You

Transgirlenstein

Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

Marguerite

I have a little house in which I live all alone. It has no doors or windows, and if I want to go out I must break through the wall.
*R.R*A.A*O.O*Wiki*Bordello*Whip and Apple*
You Keep On Crying, Baby, I'll Bleed You Dry
Mar Is Currently: Taking On Threads
Check My Absence Thread For Updates, Thank You

MHaji

QuoteI have a little house in which I live all alone. It has no doors or windows, and if I want to go out I must break through the wall.

An embryo in an egg?

QuoteWhat is it no man wants to have but no man wants to lose?
A lawsuit

I wish there weren't people who wanted to have those.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

Marguerite

Quote from: MHaji on March 13, 2009, 06:20:20 PM
An embryo in an egg?

Close enough, answer was a chicken egg but it does hold the same.
*R.R*A.A*O.O*Wiki*Bordello*Whip and Apple*
You Keep On Crying, Baby, I'll Bleed You Dry
Mar Is Currently: Taking On Threads
Check My Absence Thread For Updates, Thank You

Inkidu

You're trapped in a room with stone walls, it has no windows and no door. All that is in it is a table and a wood saw. How do you get out?
If you're searching the lines for a point, well you've probably missed it; there was never anything there in the first place.

saturnschild

you use the table to make a door
The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

Inkidu

Quote from: saturnschild on March 13, 2009, 07:11:03 PM
you use the table to make a door
Close. You saw the table in half, put the two halves together, and make a whole.
If you're searching the lines for a point, well you've probably missed it; there was never anything there in the first place.

MHaji

QuoteYou're trapped in a room with stone walls, it has no windows and no door. All that is in it is a table and a wood saw. How do you get out?

You embed the saw in the table and fall upon it, seeking the sweet release of death. Oh, wait, is this a children's riddle?

Huh. None of mine have been answered, or even tried, yet. We'll try another:

Strange it may be, but my prey swallows me,
Then I spew out my guts, though I haven't a throat.
Without mate or wife, I write offspring to life,
And then each one escapes, having borrowed a coat.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

MusicNeverDies

Quote from: trippingsatyr on March 13, 2009, 08:15:44 AM
Not sure about that one.  My favorites are:

What is it no man wants to have but no man wants to lose?
A bald head

saturnschild

Pronounced as one letter,
And written with three,
Two letters there are,
And two only in me.
I'm double, I'm single,
I'm black, blue, and gray,
I'm read from both ends,
And the same either way.
What am I?

Father just told me this one.
The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

MusicNeverDies

Quote from: saturnschild on March 14, 2009, 11:20:31 AM
Pronounced as one letter,
And written with three,
Two letters there are,
And two only in me.
I'm double, I'm single,
I'm black, blue, and gray,
I'm read from both ends,
And the same either way.
What am I?

Father just told me this one.
Eye

saturnschild

The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

Nadir

Quote from: MHaji on March 13, 2009, 10:24:02 AM
Why is a Raven like a writing desk?

Lewis Carroll never gave an answer, but there are a few good ones.

Oh, he did. He answered it in 1896. "Because it can produce a few notes, tho they are very flat; and it is nevar put with the wrong end in front!"

*adjusts monocle*

How about this one -

'Twas whispered in heaven, 'twas muttered in hell,
And echo caught faintly the sound as it fell;
On the confines of earth 'twas permitted to rest,
And the depths of the ocean its presence confessed.
'Twill be found in the sphere when 'tis riven asunder;
'Tis seen in the lightning, and heard in the thunder.
'Twas allotted to man from his earliest breath;
It assists at his birth, and attends him in death;
It presides o'er his happiness, honour, and health;
Is the prop of his house, and the end of his wealth.
In the heap of the miser 'tis hoarded with care,
But is sure to be lost in his prodigal heir.
It begins every hope, every wish it must bound,
It prays with the hermit, with monarchs is crowned.
Without it the soldier and seaman may roam,
But woe to the wretch who expels it from home.
In the whispers of conscience 'tis sure to be found;
Nor e'en in the whirlwind of passion is drowned.
'Twill soften the heart, and though deaf to the ear,
'Twill make it acutely and constantly hear.
But, in short, let it rest like a beautiful flower;
Oh, breathe on it softly, it dies in an hour.

MHaji

Quote"Because it can produce a few notes, tho they are very flat; and it is nevar put with the wrong end in front!"

Huh! I've heard that one, but never attributed to Carroll. I prefer the simple, "Poe wrote on both."

I won't answer Eden's second, because I've heard it, and it's one of the greatest riddles ever - not for its concept and answer, but for the sheer brilliance of the wordplay. It's over 200 years old, I believe.

Here's one that I love:

My first in my third is most awful at sea,
But many survive it, and so, then, may we.
My third in my first is the voice of the wood,
And type of all things that are noble and good.
You ask for my second? I've mentioned it twice;
In these very lines you will meet with it thrice.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

MHaji

Requests like these, long as they may be,
Stop just short of common courtesy.


- Dorothy Sayers
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

Hippie

Quote from: saturnschild on March 13, 2009, 08:17:09 AM
Why is a Raven like a writing desk?

yeah try to figure that on out.
Actually.. The answer to this riddle is there is no real answer. He created this riddle to make people think. He knew people would come up with ridiculous answers that seem like they could be right.. but in the end are all wrong. Peple think just because its a riddle there should be an answer, but in the end, there is no real answer.
"When the power of love overcomes the love of power the world will know peace."

saturnschild

A man pushes his car to a hotel to find that he is bankrupted. Why is that?
The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

Hippie

Quote from: saturnschild on April 03, 2009, 03:43:17 PM
A man pushes his car to a hotel to find that he is bankrupted. Why is that?

He was playing monopoly!!!
"When the power of love overcomes the love of power the world will know peace."

Hippie

One word in this sentence is misspelled. What is it?
"When the power of love overcomes the love of power the world will know peace."

Tatterdemalion

Quote from: Hippie on April 03, 2009, 04:30:11 PM
One word in this sentence is misspelled. What is it?

"Misspelled?"

Here's an ancient one from Finland, roughly translated:
"Old hag, twinkly-eyed, roams from home to home begging for a light, while from beneath her black hem peek out a thief and a lover."

MHaji

Quote"Old hag, twinkly-eyed, roams from home to home begging for a light, while from beneath her black hem peek out a thief and a lover."

My instinct is to say "nightfall." The nightfall rides across the land from east to west as the sun sets, its eyes the twinkling stars. The lamps and candles of houses light up in its wake, thieves poach, lovers make their assignations.

But this seems overcomplicated.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

Rider of Wind

This is a classic:

What crawls on four legs in the morning, two in the afternoon and three in the evening?
Not currently taking new roleplays.
Rider's A/A's Update 10-20-14~ O/O's
Posting rate: On Hiatus until June 2nd.

Tatterdemalion

Quote from: MHaji on April 04, 2009, 01:25:06 AMBut this seems overcomplicated.

Actually, you're quite right: nightfall is the correct answer.

Hippie

Quote from: Rider of the Wind on April 04, 2009, 01:36:20 AM
This is a classic:

What crawls on four legs in the morning, two in the afternoon and three in the evening?

Man
"When the power of love overcomes the love of power the world will know peace."

Rider of Wind

Not currently taking new roleplays.
Rider's A/A's Update 10-20-14~ O/O's
Posting rate: On Hiatus until June 2nd.

Nadir

Quote from: Hippie on April 03, 2009, 02:53:42 PM
Actually.. The answer to this riddle is there is no real answer. He created this riddle to make people think. He knew people would come up with ridiculous answers that seem like they could be right.. but in the end are all wrong. Peple think just because its a riddle there should be an answer, but in the end, there is no real answer.

But he did answer it. See my previous post.

saturnschild

Six glasses are in a row.
The first three are full of juice; the second three are empty.
By moving only one glass,
can you arrange them so empty and full glasses alternate?
The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

MusicNeverDies

Quote from: saturnschild on April 04, 2009, 08:33:42 PM
Six glasses are in a row.
The first three are full of juice; the second three are empty.
By moving only one glass,
can you arrange them so empty and full glasses alternate?
Lift the second glass and pour the contents into the 5th glass, then put the empty second glass back in place.

saturnschild

The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

Duncan

Young I am tall , Old I am short what am I?

MusicNeverDies

Quote from: Duncan on April 13, 2009, 09:24:38 AM
Young I am tall , Old I am short what am I?
DNA and candles come to mind.

Duncan

candles it is love.