What Tarot Card Are You?

Started by Stattick, March 03, 2009, 08:54:30 AM

Previous topic - Next topic

0 Members and 1 Guest are viewing this topic.

Stattick



You are The Devil
Materiality. Material Force. Material temptation; sometimes obsession

The Devil is often a great card for business success; hard work and ambition.

Perhaps the most misunderstood of all the major arcana, the Devil is not really "Satan" at all, but Pan the half-goat nature god and/or Dionysius. These are gods of pleasure and abandon, of wild behavior and unbridled desires. This is a card about ambitions; it is also synonymous with temptation and addiction. On the flip side, however, the card can be a warning to someone who is too restrained, someone who never allows themselves to get passionate or messy or wild - or ambitious. This, too, is a form of enslavement. As a person, the Devil can stand for a man of money or erotic power, aggressive, controlling, or just persuasive. This is not to say a bad man, but certainly a powerful man who is hard to resist. The important thing is to remember that any chain is freely worn. In most cases, you are enslaved only because you allow it.

Take the Test to Find Out.

EDIT to add: Yeah, The Devil certainly fits me. I'm a man more prone to follow his passions then his head. Sometimes it leads me right, and sometimes wrong, but it's almost always an interesting ride.  ;)
O/O   A/A

Dawg



You are The Tower

Ambition, fighting, war, courage. Destruction, danger, fall, ruin.

The Tower represents war, destruction, but also spiritual renewal. Plans are disrupted. Your views and ideas will change as a result.

The Tower is a card about war, a war between the structures of lies and the lightning flash of truth. The Tower stands for "false concepts and institutions that we take for real." You have been shaken up; blinded by a shocking revelation. It sometimes takes that to see a truth that one refuses to see. Or to bring down beliefs that are so well constructed. What's most important to remember is that the tearing down of this structure, however painful, makes room for something new to be built.

<a href="http://www.flarn.com/~warlock/tarot?target=_blank>Take the Test to Find Out.</a>
[tr][td]
"sEx is LikE aiR..
iTs noT reaLLy tHat imPortAnt
untiL yoU're noT geTtiNg anY.."
[/td][td]
   *******   [/td][td]
Suffering should be creative,
it should give birth to something good and lovely
 ~ Chinua Achebe
[/td][/tr][/table]

Bliss

You are the World



Completion, Good Reward.

The World is the final card of the Major Arcana, and as such represents saturnian energies, time, and completion.

The World card pictures a dancer in a Yoni (sometimes made of laurel leaves). The Yoni symbolizes the great Mother, the cervix through which everything is born, and also the doorway to the next life after death. It is indicative of a complete circle. Everything is finally coming together, successfully and at last. You will get that Ph.D. you've been working for years to complete, graduate at long last, marry after a long engagement, or finish that huge project. This card is not for little ends, but for big ones, important ones, ones that come with well earned cheers and acknowledgements. Your hard work, knowledge, wisdom, patience, etc, will absolutely pay-off; you've done everything right.

Take the Test to Find Out.


I found this interesting; my normal significator is The Star.

Also: Their URL doesn't work right, you have to mess with it. Or click mine, which I fixed.
O/O ~ Wiki ~ A/A ~ Discord: Bliss#0337
I must not fear. Fear is the mind-killer. Fear is the little-death that brings total obliteration. I will face my fear. I will permit it to pass over me and through me. And when it has gone past I will turn the inner eye to see its path. Where the fear has gone there will be nothing.
Only I will remain.
<3 <3 <3

Maeven



You are the High Priestess

Science, Wisdom, Knowledge, Education.

The High Priestess is the card of knowledge, instinctual, supernatural, secret knowledge. She holds scrolls of arcane information that she might, or might not reveal to you. The moon crown on her head as well as the crescent by her foot indicates her willingness to illuminate what you otherwise might not see, reveal the secrets you need to know. The High Priestess is also associated with the moon however and can also indicate change or fluxuation, particularily when it comes to your moods.
What a wicked game to play, to make me feel this way.
What a wicked thing to do, to let me dream of you.
What a wicked thing to say, you never felt this way.
What a wicked thing to do, to make me dream of you. 


The Cardinal Rule

Marguerite


You are The Moon
Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.
*R.R*A.A*O.O*Wiki*Bordello*Whip and Apple*
You Keep On Crying, Baby, I'll Bleed You Dry
Mar Is Currently: Taking On Threads
Check My Absence Thread For Updates, Thank You

Amberghylles



You are The Star

Hope, expectation, Bright promises.

The Star is one of the great cards of faith, dreams realised

The Star is a card that looks to the future. It does not predict any immediate or powerful change, but it does predict hope and healing. This card suggests clarity of vision, spiritual insight. And, most importantly, that unexpected help will be coming, with water to quench your thirst, with a guiding light to the future. They might say you're a dreamer, but you're not the only one.

Hmm... I don't do more than dabble so I can't say if this fits previous patterns or not. 

Lilias

#6


You are The Empress
Beauty, happiness, pleasure, success, luxury, dissipation.

The Empress is associated with Venus, the feminine planet, so it represents, beauty, charm, pleasure, luxury, and delight. You may be good at home decorating, art or anything to do with making things beautiful.

The Empress is a creator, be it creation of life, of romance, of art or business. While the Magician is the primal spark, the idea made real, and the High Priestess is the one who gives the idea a form, the Empress is the womb where it gestates and grows till it is ready to be born. This is why her symbol is Venus, goddess of beautiful things as well as love. Even so, the Empress is more Demeter, goddess of abundance, then sensual Venus. She is the giver of Earthly gifts, yet at the same time, she can, in anger withhold, as Demeter did when her daughter, Persephone, was kidnapped. In fury and grief, she kept the Earth barren till her child was returned to her.
To go in the dark with a light is to know the light.
To know the dark, go dark. Go without sight,
and find that the dark, too, blooms and sings,
and is traveled by dark feet and dark wings.
~Wendell Berry

Double Os <> Double As (updated Mar 30) <> The Hoard <> 50 Tales 2024 <> The Lab <> ELLUIKI

consortium11


Skill, wisdom, adaptation. Craft, cunning, depending on dignity.

Eleoquent and charismatic both verbally and in writing, you are clever, witty, inventive and persuasive.

The Magician is the male power of creation, creation by willpower and desire. In that ancient sense, it is the ability to make things so just by speaking them aloud. Reflecting this is the fact that the Magician is represented by Mercury. He represents the gift of tongues, a smooth talker, a salesman. Also clever with the slight of hand and a medicine man - either a real doctor or someone trying to sell you snake oil

Lady Annabelle



You are the High Priestess

Science, Wisdom, Knowledge, Education.

The High Priestess is the card of knowledge, instinctual, supernatural, secret knowledge. She holds scrolls of arcane information that she might, or might not reveal to you. The moon crown on her head as well as the crescent by her foot indicates her willingness to illuminate what you otherwise might not see, reveal the secrets you need to know. The High Priestess is also associated with the moon however and can also indicate change or fluxuation, particularily when it comes to your moods.

I always knew there was a reason that I liked Maeven.  You know, besides her beautiful shoes.   ;)
All About Me  Where Am I?  Pixi's Twin  Miss Marguerite's Wife **True Girl Gamer**

"If all else perished, and he remained, I should still continue to be; But if all else remained, and he were annihilated, the universe would turn to a mighty stranger: I should not seem a part of it." ~ Emily Bronte

"My heart beat so hard when I was near him, I feared he could hear my secret longing for him." ~ Destiny Vaestus

Diabolus Lupus


You are The Wheel of Fortune
Good fortune and happiness but sometimes a species of intoxication with success
The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.

Silver



You are The Moon

Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.

What Tarot Card are You?Take the Test to Find Out.
O/O's  Request Thread  A/A's
Now Playing: Star - ♡ Machinedrum (A$AP Ferg Remix)
People fear what they don't understand, But then they get mad because they don't dare to do it, Everybody a shinin' star, they ain't get far so they can't prove it, Most stars foolish, full of gas, useless, Pushin' bad influence, wonder what happened to 'em?, They say hurt people hurt people, guess that is proven, They put on a mask to mask feelings, Fill the universe with mass ceilings, Most people not even tappin' in...♡

Transgirlenstein

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Magician</font></h2>
<p align="center"><font face="Verdana">Skill, wisdom, adaptation. Craft, cunning, depending on dignity.</font></p>
<p align="center"><font face="Verdana">Eleoquent and charismatic&nbsp;both verbally and in writing, 
you are clever, witty, inventive and persuasive.</font></p>
<p align="center"><font face="Verdana">The Magician is the male power of creation, creation by willpower and desire. In that ancient sense, it is the ability to make things so just by speaking them aloud. Reflecting this is the fact that the Magician is represented by Mercury. He represents the gift of tongues, a smooth talker, a salesman. Also clever with the slight of hand and a medicine man - either a real doctor or someone trying to sell you snake oil.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>
Busy with freelance writing work.  Replies slow.  Feel free to prod me. 

Formally Tripping Satyr, Tripping Snake and QueenTrippingserpent.  Often known as Trip.

Ons/Offs: https://elliquiy.com/forums/index.php?topic=19217.0

Seeking Games!: https://elliquiy.com/forums/index.php?topic=71239.0

jouzinka

You are The Hierophant (Heavenly Master)



Divine Wisdom. Manifestation. Explanation. Teaching.

All things relating to education, patience, help from superiors.The Hierophant is often considered to be a Guardian Angel.

The Hierophant's purpose is to bring the spiritual down to Earth. Where the High Priestess between her two pillars deals with realms beyond this Earth, the Hierophant (or High Priest) deals with worldly problems. He is well suited to do this because he strives to create harmony and peace in the midst of a crisis. The Hierophant's only problem is that he can be stubborn and hidebound. At his best, he is wise and soothing, at his worst, he is an unbending traditionalist.
Story status: Not Available
Life Status: Just keep swimming...
Working on: N/A

miss Hysteria


Idea, thought, spirituality, that which endeavours to rise above the material.

The Fool is the card of infinite possibilities. The bag on the staff indicates that he has all he need to do or be anything he wants, he has only to stop and unpack. He is on his way to a brand new beginning. But the card carries a little bark of warning as well. Stop daydreaming and fantasising and watch your step, lest you fall and end up looking the fool.


WyldRanger

#14
You are The Hierophant

Divine Wisdom. Manifestation. Explanation. Teaching.

All things relating to education, patience, help from superiors.The Hierophant is often considered to be a Guardian Angel.

The Hierophant's purpose is to bring the spiritual down to Earth. Where the High Priestess between her two pillars deals with realms beyond this Earth, the Hierophant (or High Priest) deals with worldly problems. He is well suited to do this because he strives to create harmony and peace in the midst of a crisis. The Hierophant's only problem is that he can be stubborn and hidebound. At his best, he is wise and soothing, at his worst, he is an unbending traditionalist.

The Overlord



You are The Hermit




Prudence, Caution, Deliberation.

The Hermit points to all things hidden, such as knowledge and inspiration, hidden enemies. The illumination is from within, and retirement from participation in current events.

The Hermit is a card of introspection, analysis and, well, virginity. You do not desire to socialize; the card indicates, instead, a desire for peace and solitude. You prefer to take the time to think, organize, ruminate, take stock. There may be feelings of frustration and discontent but these feelings eventually lead to enlightenment, illumination, clarity.

The Hermit represents a wise, inspirational person, friend, teacher, therapist. This a person who can shine a light on things that were previously mysterious and confusing.


HairyHeretic

Hairys Likes, Dislikes, Games n Stuff

Cattle die, kinsmen die
You too one day shall die
I know a thing that will never die
Fair fame of one who has earned it.

Will

If you can heal the symptoms, but not affect the cause
It's like trying to heal a gunshot wound with gauze

One day, I will find the right words, and they will be simple.
- Jack Kerouac

Skye

#18

You are The Empress
Beauty, happiness, pleasure, success, luxury, dissipation.
The Empress is associated with Venus, the feminine planet, so it represents, beauty, charm, pleasure, luxury, and delight. You may be good at home decorating, art or anything to do with making things beautiful.
The Empress is a creator, be it creation of life, of romance, of art or business. While the Magician is the primal spark, the idea made real, and the High Priestess is the one who gives the idea a form, the Empress is the womb where it gestates and grows till it is ready to be born. This is why her symbol is Venus, goddess of beautiful things as well as love. Even so, the Empress is more Demeter, goddess of abundance, then sensual Venus. She is the giver of Earthly gifts, yet at the same time, she can, in anger withhold, as Demeter did when her daughter, Persephone, was kidnapped. In fury and grief, she kept the Earth barren till her child was returned to her.


What Tarot Card are You?

[tr][td]
   
          [/td][/tr][/table]

Inkidu

<p align="center"></p>

You are The Hierophant

Divine Wisdom. Manifestation. Explanation. Teaching.

All things relating to education, patience, help from superiors.The Hierophant is often considered to be a Guardian Angel.

The Hierophant's purpose is to bring the spiritual down to Earth. Where the High Priestess between her two pillars deals with realms beyond this Earth, the Hierophant (or High Priest) deals with worldly problems. He is well suited to do this because he strives to create harmony and peace in the midst of a crisis. The Hierophant's only problem is that he can be stubborn and hidebound. At his best, he is wise and soothing, at his worst, he is an unbending traditionalist.
If you're searching the lines for a point, well you've probably missed it; there was never anything there in the first place.

Myrleena

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Magician</font></h2>
<p align="center"><font face="Verdana">Skill, wisdom, adaptation. Craft, cunning, depending on dignity.</font></p>
<p align="center"><font face="Verdana">Eleoquent and charismatic&nbsp;both verbally and in writing, 
you are clever, witty, inventive and persuasive.</font></p>
<p align="center"><font face="Verdana">The Magician is the male power of creation, creation by willpower and desire. In that ancient sense, it is the ability to make things so just by speaking them aloud. Reflecting this is the fact that the Magician is represented by Mercury. He represents the gift of tongues, a smooth talker, a salesman. Also clever with the slight of hand and a medicine man - either a real doctor or someone trying to sell you snake oil.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>

Hmm...not sure about this one.

Apple of Eris



You are The Wheel of Fortune
Good fortune and happiness but sometimes a species of
intoxication with success.

The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change
Men are those creatures with two legs and eight hands.  ~Jayne Mansfield
To be sure of hitting the target, shoot first, then call whatever you hit the target. ~Ashleigh Brilliant

Ons/Offs
Stories I'm Seeking

Nadir

I'm a wheel o' fortune, too ^_^

Duchess




You are The Moon

Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.

MHaji

Mine. It's an easy card to interpret as somehow involving suicide, but that figure isn't hanging by its neck. MOST FAMOUS USE: That scene in The Empire Strikes Back in the cave?

(I don't really like the sets offered, so:)



You are the Hanged Man

Self-sacrifice, Sacrifice, Devotion, Bound.

With the Hanged man there is often a sense of fatalism, waiting for something to happen. Or a fear of loss from a situation, rather than gain.

The Hanged Man is perhaps the most fascinating card in the deck. It reflects the story of Odin who offered himself as a sacrifice in order to gain knowledge. Hanging from the world tree, wounded by a spear, given no bread or mead, he hung for nine days. On the last day, he saw on the ground runes that had fallen from the tree, understood their meaning, and, coming down, scooped them up for his own. All knowledge is to be found in these runes.

The Hanged Man, in similar fashion, is a card about suspension, not life or death. It signifies selflessness, sacrifice and prophecy. You make yourself vulnerable and in doing so, gain illumination. You see the world differently, with almost mystical insights.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

The Golden Touch

#25
   

You are The Lovers



Motive, power, and action, arising from Inspiration and Impulse.
The Lovers represents intuition and inspiration. Very often a choice needs to be made.

Originally, this card was called just LOVE. And that's actually more apt than Lovers. Love follows in this sequence of growth and maturity. And, coming after the Emperor, who is about control, it is a radical change in perspective. LOVE is a force that makes you choose and decide for reasons you often can't understand; it makes you surrender control to a higher power. And that is what this card is all about. Finding something or someone who is so much a part of yourself, so perfectly attuned to you and you to them, that you cannot, dare not resist. This card indicates that the you have or will come across a person, career, challenge or thing that you will fall in love with. You will know instinctively that you must have this, even if it means diverging from your chosen path. No matter the difficulties, without it you will never be complete.

"Yesterday was the easy day."
Ideas (Open) /What Floats My Boat\ Absences

Ket


You are The Wheel of Fortune

Good fortune and happiness but sometimes a species of intoxication with success

The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.


Yeah, if you ask certain people, that describes me.

she wears strength and darkness equally well, the girl has always been half goddess, half hell

you can find me on discord Ket#8117
Ons & Offs~Menagerie~Pulse~Den of Iniquity
wee little Ketlings don't yet have the ability to spit forth flame with the ferocity needed to vanquish a horde of vehicular bound tiny arachnids.

Imogen



You are The Moon

Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.
[tr][td]
[/td]
[td][/td]
[td]Woo's and Won'ts / Absences
Stor-E Writers Registry[/td]
[td][/td]
[td][/td]
[/tr][/table]

zekestone



You are The Devil
Materiality. Material Force. Material temptation; sometimes obsession

The Devil is often a great card for business success; hard work and ambition.

Perhaps the most misunderstood of all the major arcana, the Devil is not really "Satan" at all, but Pan the half-goat nature god and/or Dionysius. These are gods of pleasure and abandon, of wild behavior and unbridled desires. This is a card about ambitions; it is also synonymous with temptation and addiction. On the flip side, however, the card can be a warning to someone who is too restrained, someone who never allows themselves to get passionate or messy or wild - or ambitious. This, too, is a form of enslavement. As a person, the Devil can stand for a man of money or erotic power, aggressive, controlling, or just persuasive. This is not to say a bad man, but certainly a powerful man who is hard to resist. The important thing is to remember that any chain is freely worn. In most cases, you are enslaved only because you allow it.


Edit: Shit i'm the devil! Erm I didn't expect this at all but maybe it's true.
To Learn more follow this link: <a href="https://elliquiy.com/forums/index.php?topic=31216.msg1642960#msg1642960" target="_blank" rel="nofollow">--- My Long Ass List of On's & Off's ---</a>

To Learn more follow this link: <a href="https://elliquiy.com/forums/onsoffs.php?u=5392" target="_blank" rel="nofollow">--- My Long Ass List of On's & Off's On E ---</a>

saturnschild

You are The Devil
Materiality. Material Force. Material temptation; sometimes obsession
The Devil is often a great card for business success; hard work and ambition.
Perhaps the most misunderstood of all the major arcana, the Devil is not really &quot;Satan&quot; at all, but Pan the half-goat nature god and/or Dionysius. These are gods of pleasure and abandon, of wild behavior and unbridled desires. This is a card about ambitions; it is also synonymous with temptation and addiction. On the flip side, however, the card can be a warning to someone who is too restrained, someone who never allows themselves to get passionate or messy or wild - or ambitious. This, too, is a form of enslavement. As a person, the Devil can stand for a man of money or erotic power, aggressive, controlling, or just persuasive. This is not to say a bad man, but certainly a powerful man who is hard to resist. The important thing is to remember that any chain is freely worn. In most cases, you are enslaved only because you allow it.

Really didn't see that coming. But oh thee well.
The greatest thing you can ever learn, is just to love and be loved in return.-Moulin Rouge
In a world ruled by the dead, we are forced to finally start living.- Walking Dead
And I heard a voice in the midst of the four beasts, And I looked and behold: a pale horse. And his name, that sat on him, was Death. And Hell followed with him. - Johnny Cash

Ons and Offs saturn

Ignaddio

Vidi, Vici, Veni*I sang, too.
 Like the Avatar? I drew it myself.

Josietta


You are The Empress
Beauty, happiness, pleasure, success, luxury, dissipation.
The Empress is associated with Venus, the feminine planet, so it represents, beauty, charm, pleasure, luxury, and delight. You may be good at home decorating, art or anything to do with making things beautiful.
The Empress is a creator, be it creation of life, of romance, of art or business. While the Magician is the primal spark, the idea made real, and the High Priestess is the one who gives the idea a form, the Empress is the womb where it gestates and grows till it is ready to be born. This is why her symbol is Venus, goddess of beautiful things as well as love. Even so, the Empress is more Demeter, goddess of abundance, then sensual Venus. She is the giver of Earthly gifts, yet at the same time, she can, in anger withhold, as Demeter did when her daughter, Persephone, was kidnapped. In fury and grief, she kept the Earth barren till her child was returned to her.
What Tarot Card are You?
Take the Test to Find Out.

      ❤️🧡💛💚💙💜🖤🤍💖                    ❤️🧡💛💚💙💜🖤🤍💖
                                 O.Os   / A.As / Ideas 
                           Warning:  Finicky Muse Ahead!


Priscilla



You are The Tower

Ambition, fighting, war, courage. Destruction, danger, fall, ruin.

The Tower represents war, destruction, but also spiritual renewal. Plans are disrupted. Your views and ideas will change as a result.

The Tower is a card about war, a war between the structures of lies and the lightning flash of truth. The Tower stands for "false concepts and institutions that we take for real." You have been shaken up; blinded by a shocking revelation. It sometimes takes that to see a truth that one refuses to see. Or to bring down beliefs that are so well constructed. What's most important to remember is that the tearing down of this structure, however painful, makes room for something new to be built.

Cherri Tart



You are The Empress
Beauty, happiness, pleasure, success, luxury, dissipation.

The Empress is associated with Venus, the feminine planet, so it represents, beauty, charm, pleasure, luxury, and delight. You may be good at home decorating, art or anything to do with making things beautiful.

The Empress is a creator, be it creation of life, of romance, of art or business. While the Magician is the primal spark, the idea made real, and the High Priestess is the one who gives the idea a form, the Empress is the womb where it gestates and grows till it is ready to be born. This is why her symbol is Venus, goddess of beautiful things as well as love. Even so, the Empress is more Demeter, goddess of abundance, then sensual Venus. She is the giver of Earthly gifts, yet at the same time, she can, in anger withhold, as Demeter did when her daughter, Persephone, was kidnapped. In fury and grief, she kept the Earth barren till her child was returned to her.
you were never able to keep me breathing as the water rises up again



O/O, Cherri Flavored

Mnemaxa

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Magician</font></h2>
<p align="center"><font face="Verdana">Skill, wisdom, adaptation. Craft, cunning, depending on dignity.</font></p>
<p align="center"><font face="Verdana">Eleoquent and charismatic&nbsp;both verbally and in writing, 
you are clever, witty, inventive and persuasive.</font></p>
<p align="center"><font face="Verdana">The Magician is the male power of creation, creation by willpower and desire. In that ancient sense, it is the ability to make things so just by speaking them aloud. Reflecting this is the fact that the Magician is represented by Mercury. He represents the gift of tongues, a smooth talker, a salesman. Also clever with the slight of hand and a medicine man - either a real doctor or someone trying to sell you snake oil.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>


And no one is surprised.

The Well of my Dreams is Poisoned; I draw off the Poison, which becomes the Ink of my Authorship, the Paint upon my Brush.

Chris Brady

I'm the Devil, and it couldn't possibly be more wrong about me...  Wow.
My O&Os Peruse at your doom.

So I make a A&A thread but do I put it here?  No.  Of course not.

Also, I now come with Kung-Fu Blog action.  Here:  Where I talk about comics and all sorts of gaming

Mnemaxa

the devil isn't evil - it's change and growth through hardship.

The Well of my Dreams is Poisoned; I draw off the Poison, which becomes the Ink of my Authorship, the Paint upon my Brush.

Chris Brady

Like I said, nothing like me.
My O&Os Peruse at your doom.

So I make a A&A thread but do I put it here?  No.  Of course not.

Also, I now come with Kung-Fu Blog action.  Here:  Where I talk about comics and all sorts of gaming

Stattick

Quote from: Chris Brady on March 07, 2009, 11:14:21 PM
Like I said, nothing like me.

They all say that when just falling to the dark side. Give him time... he'll come around. They always do.  >:)




Kidding
O/O   A/A

Destiny Ascension



You are Strength
Courage, strength, fortitude. Power not arrested in the act of judgement, but passing on to further action, sometimes obstinacy.

This is a card of courage and energy. It represents both the Lion's hot, roaring energy, and the Maiden's steadfast will. The innocent Maiden is unafraid, undaunted, and indomitable. In some cards she opens the lion's mouth, in others she shuts it. Either way, she proves that inner strength is more powerful than raw physical strength. That forces can be controlled and used to score a victory is very close to the message of the Chariot, which might be why, in some decks, it is Justice that is card 8 instead of Strength. With strength you can control not only the situation, but yourself. It is a card about anger and impulse management, about creative answers, leadership and maintaining one's personal honor. It can also stand for a steadfast friend.
"Build courage when courage seems to fail, gain faith when there seems to be little cause for faith, create hope when hope becomes forlorn."
Andraste's flaming sword! I know where babies come from!

Chris Brady

I think part of the issue is that it depends on which style of card you choose that is a big factor as to what type of card you are...
My O&Os Peruse at your doom.

So I make a A&A thread but do I put it here?  No.  Of course not.

Also, I now come with Kung-Fu Blog action.  Here:  Where I talk about comics and all sorts of gaming

Chris Brady

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Hermit</font></h2>
<p align="center"><font face="Verdana">Prudence, Caution, Deliberation.</font></p>
<p align="center"><font face="Verdana">The Hermit points to all things hidden, such as knowledge and inspiration,hidden enemies. The illumination is from within, and retirement from participation in current events.</font></p>
<p align="center"><font face="Verdana">The Hermit is a card of introspection, analysis and, well, virginity. You do not desire to socialize; the card indicates, instead, a desire for peace and solitude. You&nbsp;prefer&nbsp;to&nbsp;take&nbsp;the&nbsp;time to think, organize, ruminate, take stock. There may be feelings of frustration and discontent but these&nbsp;feelings&nbsp;eventually&nbsp;lead to enlightenment, illumination, clarity. </font></p>
<p align="center"><font face="Verdana">The Hermit represents a wise, inspirational person, friend, teacher, therapist. This a person who can shine a light on things that were previously mysterious and confusing.</font><font face="Verdana"></font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>


A little extreme, but this is me.  It's either the Hermit or the Chariot.
My O&Os Peruse at your doom.

So I make a A&A thread but do I put it here?  No.  Of course not.

Also, I now come with Kung-Fu Blog action.  Here:  Where I talk about comics and all sorts of gaming

Hunter

Aru?

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Hierophant</font></h2>
<p align="center"><font face="Verdana">Divine Wisdom. Manifestation. Explanation. Teaching. </font></p>
<p align="center"><font face="Verdana">All things relating to education, patience, help from superiors.The Hierophant is often considered to be a Guardian Angel.</font></p>
<p align="center"><font face="Verdana">The Hierophant's purpose is to bring the spiritual down to Earth. Where the High Priestess between her two pillars deals with realms beyond this Earth, the Hierophant (or High Priest) deals with worldly problems. He is well suited to do this because he strives to create harmony and peace in the midst of a crisis. The Hierophant's only problem is that he can be stubborn and hidebound. At his best, he is wise and soothing, at his worst, he is an unbending traditionalist. </font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>

Ixy

WHEEL--   OF--   FORTUNE!!!

Yeah, not what I was expecting, but I'll take it. 

Neat thread, guys.  Good find.
______________________
The big print giveth, the small print taketh away.

Urialen




You are The Hierophant

Divine Wisdom. Manifestation. Explanation. Teaching.
All things relating to education, patience, help from superiors.The Hierophant is often considered to be a Guardian Angel.
The Hierophant's purpose is to bring the spiritual down to Earth. Where the High Priestess between her two pillars deals with realms beyond this Earth, the Hierophant (or High Priest) deals with worldly problems. He is well suited to do this because he strives to create harmony and peace in the midst of a crisis. The Hierophant's only problem is that he can be stubborn and hidebound. At his best, he is wise and soothing, at his worst, he is an unbending traditionalist.

Fair enough

Vella

#45
This was a little surprising,  I thought I was something else but after reading the description, I guess.. yeah..it makes sense.

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Moon</font></h2>
<p align="center"><font face="Verdana">Hope, expectation, Bright promises.</font></p>
<p align="center"><font face="Verdana">The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.</font></p>
<p align="center"><font face="Verdana">The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you&nbsp;have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
<a href="http://www.flarn.com/~warlock/tarot" target="_blank">Take the Test to Find Out.</a></font></p>
I shall be telling this with a sigh
Somewhere ages and ages hence:
Two roads diverged in a wood, and I—
I took the one less traveled by,
And that has made all the difference.

On's and off's
https://elliquiy.com/forums/index.php?topic=19527.msg758142#msg758142

RH O/Os  http://rh.greydawn.net/browse.php?c=Rhiver

Wistful Dream


You are The Empress

Beauty, happiness, pleasure, success, luxury, dissipation.
The Empress is associated with Venus, the feminine planet, so it represents, beauty, charm, pleasure, luxury, and delight. You may be good at home decorating, art or anything to do with making things beautiful.

The Empress is a creator, be it creation of life, of romance, of art or business. While the Magician is the primal spark, the idea made real, and the High Priestess is the one who gives the idea a form, the Empress is the womb where it gestates and grows till it is ready to be born. This is why her symbol is Venus, goddess of beautiful things as well as love. Even so, the Empress is more Demeter, goddess of abundance, then sensual Venus. She is the giver of Earthly gifts, yet at the same time, she can, in anger withhold, as Demeter did when her daughter, Persephone, was kidnapped. In fury and grief, she kept the Earth barren till her child was returned to her.



Elohim



You are The Star

Hope, expectation, Bright promises.

The Star is one of the great cards of faith, dreams realized

The Star is a card that looks to the future. It does not predict any immediate or powerful change, but it does predict hope and healing. This card suggests clarity of vision, spiritual insight. And, most importantly, that unexpected help will be coming, with water to quench your thirst, with a guiding light to the future. They might say you're a dreamer, but you're not the onl

undisclosedtoyou

It say's high priestess.

Went to other quizes, said the same thing.

Once when I was younger, someone told me that my personal tarot card was Death.

Which I was happy about because it meant new beginnings I think.
"Not all who wander are aimless.  Especially not those who seek truth beyond tradition, beyond definition, beyond the image."
O/O's ~ A/A's ~ Avi's

Thufir Hawat

Took it several times with slightly different, but equally valid answers. The Wheel of Fortune seems to come up most often.
I definitely didn't expect that, but I could live with that!
Join The System Gamers List
Request thread 1 Request thread 2
Request thread 3
ONs and OFFs
"Love is a negative form of hatred." - Roger Zelazny, This Immortal

A&A thread!

Tsenta

<p align="center"></p>
<h2 align="center"><font face="Verdana">You are Death</font></h2>
<p align="center"><font face="Verdana">Change, Transformation, Alteration.</font></p>
<p align="center"><font face="Verdana">People fear this card, but if you want to change your life, this is one of the
best indicators for it. Whatever happens, life will be different. Yes, the Death card can signal a death in the right circumstances (a question about a very sick or old relative, for example), but unlike its dramatic presentation in the movies, the Death card is far more likely to signal transformation, passage, change. Scorpio, the sign of this card, has three forms: scorpion, serpent, eagle. The Death card indicates this transition from lower to higher to highest. This is a card of humility, and it may mean&nbsp;you&nbsp;have&nbsp;been&nbsp;brought low, but only so that you&nbsp;can then go higher than ever before. Death &quot;humbles&quot; all, but it also &quot;exults.&quot; Always keep in mind that on this card of darkness there is featured a sunrise as well. You could be ready for a change.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
<a href="http://www.flarn.com/~warlock/tarot" target="_blank">Take the Test to Find Out.</a></font></p>
There ain't no rest for the wicked.

[Sic Semper Tyrannis - "Thus always to tyrants"] - Marcus Junius Brutus The Younger.

Malina


You are The Sun

Happiness, Content, Joy.

The meanings for the Sun are fairly simple and consistent.

Young, healthy, new, fresh. The brain is working, things that were muddled come clear, everything falls into place, and everything seems to go your way.

The Sun is ruled by the Sun, of course. This is the light that comes after the long dark night, Apollo to the Moon's Diana. A positive card, it promises you your day in the sun. Glory, gain, triumph, pleasure, truth, success. As the moon symbolized inspiration from the unconscious, from dreams, this card symbolizes discoveries made fully consciousness and wide awake. You have an understanding and enjoyment of science and math, beautifully constructed music, carefully reasoned philosophy. It is a card of intellect, clarity of mind, and feelings of youthful energy.

Oniya

You are The Moon
Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.
"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

Saerrael



You are The Moon
Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.



A lot of Moons here? O.o

Shiri

Yup it's me lol

You are The Moon

Hope, expectation, Bright promises.

The Moon is a card of magic and mystery - when prominent you know that nothing is as it seems, particularly when it concerns relationships. All logic is thrown out the window.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition.

DairXV


You are The Magician

Skill, wisdom, adaptation. Craft, cunning, depending on dignity.

Eleoquent and charismatic&nbsp;both verbally and in writing, 
you are clever, witty, inventive and persuasive.

The Magician is the male power of creation, creation by willpower and desire. In that ancient sense, it is the ability to make things so just by speaking them aloud. Reflecting this is the fact that the Magician is represented by Mercury. He represents the gift of tongues, a smooth talker, a salesman. Also clever with the slight of hand and a medicine man - either a real doctor or someone trying to sell you snake oil.



tes11

My Ons and Offs
Apologies and Absences: -

Moon and Star


You are The Wheel of Fortune

Good fortune and happiness but sometimes a species of intoxication with success

The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.

Hee...

The Joker

#58
Intrigueing. And I'm not disagreeing at all. Except the virgin bit. Way out, mate!





You are The Hermit

Prudence, Caution, Deliberation.

The Hermit points to all things hidden, such as knowledge and inspiration,hidden enemies. The illumination is from within, and retirement from participation in current events.

The Hermit is a card of introspection, analysis and, well, virginity. You do not desire to socialize; the card indicates, instead, a desire for peace and solitude. You prefer to take the time to think, organize, ruminate, take stock. There may be feelings of frustration and discontent but these feelings eventually lead to enlightenment, illumination, clarity.

The Hermit represents a wise, inspirational person, friend, teacher, therapist. This a person who can shine a light on things that were previously mysterious and confusing.

Yakkul

#59
*pouts*  "a baby and a tyrant?"  *sigh*


You are The Emperor

Stability, power, protection, realization; a great person.

The Emperor is the great authority figure of the Tarot, so it represents
fathers, father-figures and employers. There is a lot of aggression and violence
too.

The Emperor naturally follows the Empress. Like an infant, he is filled with enthuiasm, energy, aggression. He is direct, guileless and all too often irresistible. Unfortunately, like a baby he can also be a tyrant. Impatient, demanding, controlling. In the best of circumstances, he signifies the leader that everyone wants to follow, sitting on a throne that indicates the solid foundation of an Empire he created, loves and rules with intelligence and enthusiasm. But that throne can also be a trap, a responsibility that has the Emperor feeling restless, bored and discontent.

What Tarot Card are You?
Take the Test to Find Out.

Talia

#60
You are The Wheel of Fortune

Good fortune and happiness but sometimes a species of intoxication with success

The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.<p align="center"></p>
<h2 align="center"><font face="Verdana">You are The Wheel of Fortune</font></h2>
<p align="center"><font face="Verdana">Good fortune and happiness but sometimes a species of
intoxication with success</font></p>
<p align="center"><font face="Verdana">The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>

He looks at me and my heart starts skipping beats, my face starts to glow and my eyes start to twinkle.
Imagine what he would do to me if he smiled!

Smile... it's the second best thing to do with your lips.

On's & Off's
The Oath of Drake for Group RP's
A&A

TheWriter

You are The Magician

Skill, wisdom, adaptation. Craft, cunning, depending on dignity.

Eleoquent and charismatic both verbally and in writing, you are clever, witty, inventive and persuasive.

The Magician is the male power of creation, creation by willpower and desire. In that ancient sense, it is the ability to make things so just by speaking them aloud. Reflecting this is the fact that the Magician is represented by Mercury. He represents the gift of tongues, a smooth talker, a salesman. Also clever with the slight of hand and a medicine man - either a real doctor or someone trying to sell you snake oil.

Greenthorn




You are The High Priestess


Science, Wisdom, Knowledge, Education.


The High Priestess is the card of knowledge, instinctual, supernatural, secret knowledge. She holds scrolls of arcane information that she might, or might not reveal to you. The moon crown on her head as well as the crescent by her foot indicates her willingness to illuminate what you otherwise might not see, reveal the secrets you need to know. The High Priestess is also associated with the moon however and can also indicate change or fluxuation, particularily when it comes to your moods.


What Tarot Card are You?
Take the Test to Find Out.
 

Beguile's Mistress

#63
You are The High Priestess
Science, Wisdom, Knowledge, Education.
The High Priestess is the card of knowledge, instinctual, supernatural, secret knowledge. She holds scrolls of arcane information that she might, or might not reveal to you. The moon crown on her head as well as the crescent by her foot indicates her willingness to illuminate what you otherwise might not see, reveal the secrets you need to know. The High Priestess is also associated with the moon however and can also indicate change or fluxuation, particularily when it comes to your moods.

Mithlomwen


You are The Devil

Materiality. Material Force. Material temptation; sometimes obsession

The Devil is often a great card for business success; hard work and ambition.

Perhaps the most misunderstood of all the major arcana, the Devil is not really "Satan" at all, but Pan the half-goat nature god and/or Dionysius. These are gods of pleasure and abandon, of wild behavior and unbridled desires. This is a card about ambitions; it is also synonymous with temptation and addiction. On the flip side, however, the card can be a warning to someone who is too restrained, someone who never allows themselves to get passionate or messy or wild - or ambitious. This, too, is a form of enslavement. As a person, the Devil can stand for a man of money or erotic power, aggressive, controlling, or just persuasive. This is not to say a bad man, but certainly a powerful man who is hard to resist. The important thing is to remember that any chain is freely worn. In most cases, you are enslaved only because you allow it.
Baby, it's all I know,
that your half of the flesh and blood that makes me whole...

Aiden

You are The Emperor
(Used the X/1999 tarot card set, since i like it better)


Stability, power, protection, realization; a great person.

The Emperor is the great authority figure of the Tarot, so it represents fathers, father-figures and employers. There is a lot of aggression and violence too.

The Emperor naturally follows the Empress. Like an infant, he is filled with enthuiasm, energy, aggression. He is direct, guileless and all too often irresistible. Unfortunately, like a baby he can also be a tyrant. Impatient, demanding, controlling. In the best of circumstances, he signifies the leader that everyone wants to follow, sitting on a throne that indicates the solid foundation of an Empire he created, loves and rules with intelligence and enthusiasm. But that throne can also be a trap, a responsibility that has the Emperor feeling restless, bored and discontent.

Belladonna



You are The Wheel of Fortune

Good fortune and happiness but sometimes a species of intoxication with success.

The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.

Archermonkey


You are The Sun

Happiness, Content, Joy.

The meanings for the Sun are fairly simple and consistent.

Young, healthy, new, fresh. The brain is working, things that were muddled come clear, everything falls into place, and everything seems to go your way.

The Sun is ruled by the Sun, of course. This is the light that comes after the long dark night, Apollo to the Moon's Diana. A positive card, it promises you your day in the sun. Glory, gain, triumph, pleasure, truth, success. As the moon symbolized inspiration from the unconscious, from dreams, this card symbolizes discoveries made fully consciousness and wide awake. You have an understanding and enjoyment of science and math, beautifully constructed music, carefully reasoned philosophy. It is a card of intellect, clarity of mind, and feelings of youthful energy.


What Tarot Card are You?
<a href="http://www.flarn.com/~warlock/tarot" target="_blank">Take the Test to Find Out.</a>
I'm back!  I can't guarantee any specific schedule right now, but I'm trying to get going as best I can.
If I've been in a game with you in the past and you want to restart it, please let me know!  I've sent out a bunch of PMs about this, but I know I have to send more.


[tr][td]       [/td][td]

~-~  ~-~  ~-~
How to make the Monkey happy
~-~  ~-~  ~-~
[/td][td]       [/td][td]*

*

*
[/td][td]         [/td][td]
My upcoming posts:
Bah Humbug, Bitch
The Devil's Deal
The Golden Spectre of Slavery <G>
[/td][td]         [/td][/tr][/table]

Scribbles



You are the World
Completion, Good Reward.

The World is the final card of the Major Arcana, and as such represents saturnian energies, time, and completion.

The World card pictures a dancer in a Yoni (sometimes made of laurel leaves). The Yoni symbolizes the great Mother, the cervix through which everything is born, and also the doorway to the next life after death. It is indicative of a complete circle. Everything is finally coming together, successfully and at last. You will get that Ph.D. you've been working for years to complete, graduate at long last, marry after a long engagement, or finish that huge project. This card is not for little ends, but for big ones, important ones, ones that come with well earned cheers and acknowledgements. Your hard work, knowledge, wisdom, patience, etc, will absolutely pay-off; you've done everything right.

---------------------

I was hoping for something more along the lines of "Center of the Universe" but I suppose world will do. :P
AA and OO
Current Games: Stretched Thin, Very Little Time

Archermonkey

Quote from: Scribbles link=topic=31693.msg2308308#msg2308308
I was hoping for something more along the lines of "Center of the Universe" but I suppose world will do. :P
/quote]

I got the centre of the solar system.  That's enough to make me happy ;)
I'm back!  I can't guarantee any specific schedule right now, but I'm trying to get going as best I can.
If I've been in a game with you in the past and you want to restart it, please let me know!  I've sent out a bunch of PMs about this, but I know I have to send more.


[tr][td]       [/td][td]

~-~  ~-~  ~-~
How to make the Monkey happy
~-~  ~-~  ~-~
[/td][td]       [/td][td]*

*

*
[/td][td]         [/td][td]
My upcoming posts:
Bah Humbug, Bitch
The Devil's Deal
The Golden Spectre of Slavery <G>
[/td][td]         [/td][/tr][/table]

Scribbles

Quote from: Archermonkey on October 05, 2009, 04:46:38 AM

I got the centre of the solar system.  That's enough to make me happy ;)

xD

Show off! *Sticks tongue out at Archermonkey*
AA and OO
Current Games: Stretched Thin, Very Little Time

Eva Braun

I am the moon!
Such a pretty description of it too :]
That's a very good quiz, I really enjoyed it.

The Moon is all about visions and illusions, madness, genius and poetry. This is a card that has to do with sleep, and so with both dreams and nightmares. It is a scary card in that it warns that there might be hidden enemies, tricks and falsehoods. But it should also be remembered that this is a card of great creativity, of powerful magic, primal feelings and intuition. You may be going through a time of emotional and mental trial; if you&nbsp;have any past mental problems, you must be vigilant in taking your medication but avoid drugs or alcohol, as abuse of either will cause them irreparable damage. This time however, can also result in great creativity, psychic powers, visions and insight. You can and should trust your intuition
If you can't beat 'em.. let them beat you!

xKittyx




You are the High Priestess

Science, Wisdom, Knowledge, Education.

The High Priestess is the card of knowledge, instinctual, supernatural, secret knowledge. She holds scrolls of arcane information that she might, or might not reveal to you. The moon crown on her head as well as the crescent by her foot indicates her willingness to illuminate what you otherwise might not see, reveal the secrets you need to know. The High Priestess is also associated with the moon however and can also indicate change or fluxuation, particularily when it comes to your moods.

Trieste

Quote from: Devilstrike on March 03, 2009, 12:51:12 PM

You are The Wheel of Fortune
Good fortune and happiness but sometimes a species of intoxication with success
The Wheel of Fortune is all about big things, luck, change, fortune. Almost always good fortune. You are lucky in all things that you do and happy with the things that come to you. Be careful that success does not go to your head however. Sometimes luck can change.

This.

Moonhare

You are The Lovers
Motive, power, and action, arising from Inspiration and Impulse.
The Lovers represents intuition and inspiration. Very often a choice needs to be made.
Originally, this card was called just LOVE. And that's actually more apt than "Lovers." Love follows in this sequence of growth and maturity. And, coming after the Emperor, who is about control, it is a radical change in perspective. LOVE is a force that makes you choose and decide for reasons you often can't understand; it makes you surrender control to a higher power. And that is what this card is all about. Finding something or someone who is so much a part of yourself, so perfectly attuned to you and you to them, that you cannot, dare not resist. This card indicates that the you have or will come across a person, career, challenge or thing that you will fall in love with. You will know instinctively that you must have this, even if it means diverging from your chosen path. No matter the difficulties, without it you will never be complete.

Sounds about right on things that would confuse me if I simply didn't accept that there are things I just don't understand, and am not going to try to wrap my brain around. The main one is my sudden love of writing that didn't hit me until I turned 33. I have always enjoyed reading, but writing was beyond where I wanted to be, now it is the reverse unless something really gets my attention.
(I like the artwork on this card as well.)

Ryven


You are The Hierophant

Divine Wisdom. Manifestation. Explanation. Teaching.

All things relating to education, patience, help from superiors.The Hierophant is often considered to be a Guardian Angel.

The Hierophant's purpose is to bring the spiritual down to Earth. Where the High Priestess between her two pillars deals with realms beyond this Earth, the Hierophant (or High Priest) deals with worldly problems. He is well suited to do this because he strives to create harmony and peace in the midst of a crisis. The Hierophant's only problem is that he can be stubborn and hidebound. At his best, he is wise and soothing, at his worst, he is an unbending traditionalist.


Avi

Another Hierophant.  Suits me pretty well, really.
Your reality doesn't apply to me...

Sasha


Sighs ....a strong woman.....go figure ..pouts and wanders off ..muttering ..


<p align="center"></p>
<h2 align="center"><font face="Verdana">You are Strength</font></h2>
<p align="center"><font face="Verdana">Courage, strength, fortitude. Power not arrested in the act of judgement, but passing on to further action, sometimes obstinacy.</font></P>
<p align="center"><font face="Verdana">This is a card of courage and energy. It represents both the Lion's hot, roaring energy, and the Maiden's steadfast will. The innocent Maiden is unafraid, undaunted, and indomitable. In some cards she opens the lion's mouth, in others she shuts it. Either way, she proves that inner strength is more powerful than raw physical strength. That forces can be controlled and used to score a victory is very close to the message of the Chariot, which might be why, in some decks, it is Justice that is card 8 instead of Strength. With strength you can control not only the situation, but yourself. It is a card about anger and impulse management, about creative answers, leadership and maintaining one's personal honor. It can also stand for a steadfast friend.</font></p>
<p align="center"><font size="2" face="Verdana">What Tarot Card are You?
Take the Test to Find Out.</font></p>