Possible cure/solution for HIV?

Started by Blitzy, May 15, 2011, 01:15:13 PM

Previous topic - Next topic

0 Members and 1 Guest are viewing this topic.

Blitzy

One on One stories on hold currently. Apologies to my writing partners.

Rainbowtech

This is amazing news. I seriously hope its a cure.

Nico

Very true. It's an important step, no less.

Oniya

It's kind of ironic that they're using CMV for this.  Mr. Oniya used to donate blood until his high blood pressure got in the way, and one of the reasons he was 'popular' was that he was CMV-negative, which was important for any recipient who was immuno-suppressed (whether through AIDS or chemo).
"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

Harley

This would be wonderful if it works.   I remember many reads ago that I read a newspaper about how some scientists possibly found a curl to the HIV virus, but...  It turned out to not be true, or didn't out.

So I hope this time it does work.   

Gears

It will be a wonderful day when we can eradicate this virus from the face of the Earth (like we did small pox). I hope they don't store it in the lab though; that was just stupid.

Oniya

Actually, it's a very good idea to store viruses that have been 'eradicated' in the wild.  That way, you can test to make sure that disinfectants/sanitizers will actually kill them in case there's an isolated population that humans haven't come into contact with yet.
"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

Sel Nar

The problem is that the HIV virus is (arguably) unique in that it infects all cells, but primarily (read: Almost-exclusively) attacks the T4 'Detector' cells of the immune system. So, even if countered by the proposed CMV-carried vaccine, it will only (hopefully) replace the medical regimen offered to those with HIV/AIDS, (more than likely it will merely reduce the regimen) as the HIV virii' RNA enconding will have been integrated into practically every cell of the body.

My only regret is that my Dad isn't around to read this for himself. He would have likely been one of the first lining up for human testing. (spent nearly 30 years with HIV; a lot of the medical information about the Virus that's been shared from Canadian hospitals was from his 'batch')

Mathim

Hard to really call it 'good news' when they'll probably make it so unafforable that only people like Magic Johnson can afford it...
Considering a permanent retirement from Elliquiy, but you can find me on Blue Moon (under the same username).


Oniya

That's not the CMV treatment - that guy had a bone marrow transplant from someone who had an inherited immunity (some theories are that the immunity arose during the Black Death).
"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

Lithos

Well, herpes is not exactly expensive family of virii to multiply and produce so cost should be decent. Curing the HIV with herpes is funny idea all on its own, too :p
There is no innocence, only layers upon layers of guilt
--
Wiki | O&O | A&A | Game Search

Oniya

Actually, HSV1 and 2 and CMV are in different subfamilies of the herpes family.  CMV actually multiplies more slowly.  They do keep a stock on hand in labs, though.  It's one of the viruses that they frequently test disinfectants and sanitizers against.
"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

Spoons

This is reminding me of a movie like I Am Legend... Curing one virus with another?

Either way, I've known people affected with HIV. Lets hope this is a positive step!


Looking for CONNECTIONS in Deviations! Here are a list of my ideas!

ReanimateMagnus

Quote from: Spoons on June 12, 2011, 03:54:54 PM
This is reminding me of a movie like I Am Legend... Curing one virus with another?

I really disliked that movie from a movie buff port of view, but as a lover of post-apocalyptic or mass epidemic I loved the movie.

Oniya

"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

DarklingAlice

It's something to keep an eye on, but I wouldn't get my hopes up yet. The various strains of SIV actually make poor model systems for HIV (despite being its ancestor). Definitely an avenue to pursue, but the article is making some pretty big assumptions to basically pull a bait & switch.
For every complex problem there is a solution that is simple, elegant, and wrong.


Oniya

*nods*  At one point, I did IT work at a research facility.  As I recall, the work done with SIV was more for checking to see what likely wouldn't work.  That way, they could avoid wasting time on ineffective treatments.
"Language was invented for one reason, boys - to woo women.~*~*~Don't think it's all been done before
And in that endeavor, laziness will not do." ~*~*~*~*~*~*~*~*~*~*~Don't think we're never gonna win this war
Robin Williams-Dead Poets Society ~*~*~*~*~*~*~*~*~*~*~*~*~*~Don't think your world's gonna fall apart
I do have a cause, though.  It's obscenity.  I'm for it.  - Tom Lehrer~*~All you need is your beautiful heart
O/O's Updated 5/11/21 - A/A's - Current Status! - Writing a novel - all draws for Fool of Fire up!
Requests updated March 17

MHaji

Given how incredibly quickly HIV mutates, thanks to its "sloppy" copying mechanisms, it would surprise me if any cure remained effective for long. This isn't a battle, it's an arms race.

Personally, I'm already extremely impressed and cheered by the following:

* When AIDS first started killing people, we didn't even know with certainty that the causal agent was a virus.

* For a long time, we knew it was a virus, but could do essentially nothing about it, except prevent it.

* In the nineties, better treatments extended the lifetime of HIV-positive patients.

* ... and now it's basically a very expensive and somewhat dangerous chronic illness, rather than a death sentence. (Unless you're a rapid progressor.)

This latest news is nice, but prevention and fast, aggressive testing and treatment are still the way to go. Bone marrow transplants are MUCH more dangerous than anti-HIV cocktails, and the vaccine seems like it would be more likely to work in models than in people (at least for very long.)

I worry when stories like this come out that people will get careless about safe sex.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA

DarklingAlice

Quote from: MHaji on July 17, 2011, 10:56:42 PM
* ... and now it's basically a very expensive and somewhat dangerous chronic illness, rather than a death sentence. (Unless you're a rapid progressor.)

And unless you are y'know poor and/or not first world. The idea that HIV is no longer a death sentence has done more harm to research funding and patient compliance/caution than anything else.

Anyway, the mutation rate is why we need reliable eradication therapies that target conserved elements of the virus. And the vast amount of people already infected is why developing a preventative vaccine alone won't cut it. But we're getting there, slowly.
For every complex problem there is a solution that is simple, elegant, and wrong.


MHaji

Quote
Quote* ... and now it's basically a very expensive and somewhat dangerous chronic illness, rather than a death sentence. (Unless you're a rapid progressor.)

And unless you are y'know poor and/or not first world.

Important correction duly noted, bolded for emphasis.
Ons and offs, in song form.

-

AUCUUCUACGAACGUGAAGCUGACACUCAUAUUAGUCCCAUGAUGGAA